The umgap fastq2fasta command takes one or more FASTQ files and interleaves them into a single FASTA file.

Usage

The FASTQ input files are given as command line arguments. In order, a single record is taken from each of these files, and the record header and sequence are written to standard output in FASTA format, dropping the quality scores, until any of the files runs out or records.

This command is generally used to combine two paired-end FASTQ files into a single FASTA file.

$ cat input_1.fq
@record1/1
GATAGCCGTCGAGCGTCCCGACATCCATATACAGCTCGCCGCAGTGCGTCGCCCGCACGGCATCGCGCGCCGCGATGTACGCATTCAACCAGCGTCCGAG
+
AADGGGG<GI@IIKJKKKKH4EIJCHJ9:IJHKIKDIKDKGDJD@C@<>KD=;FEA:DA=I$EEED$>C@1EDE?D:CEAC;CDE:E$D$=D$EAD?AEE
@record2/1
CCCAGGTCCCCGGCATCGTCGCGGCCTCGCCCATGATCCAGCTCCACGACCAGATCCCCGTTCCCGGCGGTAAAGAGCGCGGCGTGCTCATCCTCGGAGT
+
ADDEEG@GIGIIHKCJKH@HHGKHHKHKKJJBA.GFIGK(IHKKEKECBEEEEDIKC@H<EDBJDEA36;6EE$E:G6C=E$E@CE?EE9FEE?E:F$?$
$ cat input_2.fq
@record1/2
CATTGTTCGCTACTTTGCGGAGCGCAATTATGCCGCGGAGATCTTCTACGTGGTGCAGCAGAAGCTGGCGGGCTGGTGCGATGCGTTGTATCGGCCCGAG
+
DDDEGGG?HIHIIKHK?@2KBHGDCJKI(JEJJKKHKKHBHKKFICEICECCFFEICCCC$E6ED$?CEEDDED$DEDCFFECEEEEFB$CCEC$6C=CA
@record2/2
GGACACGCTCTCAGGACGATGGCGCGATTGCAGGACTTGCTGGATCTCCTCCGTCGCCAAGGGGACGCGCTCGGAGTGGCTCATGGAGCAGACGAGTTCT
+
AADGGGEGIIIHIJKGCK<KD:KKHI?HIHHJKFJEKKJIGE$CKHE$EE$FEEEI=EAE8EAIKFBEE$EADEEDB$DEEDE=?B6C$C$6$A$$=BEE
$ umgap fastq2fasta input_1.fq input_2.fq
>record1/1
GATAGCCGTCGAGCGTCCCGACATCCATATACAGCTCGCCGCAGTGCGTCGCCCGCACGGCATCGCGCGCCGCGATGTACGCATTCAACCAGCGTCCGAG
>record1/2
CATTGTTCGCTACTTTGCGGAGCGCAATTATGCCGCGGAGATCTTCTACGTGGTGCAGCAGAAGCTGGCGGGCTGGTGCGATGCGTTGTATCGGCCCGAG
>record2/1
CCCAGGTCCCCGGCATCGTCGCGGCCTCGCCCATGATCCAGCTCCACGACCAGATCCCCGTTCCCGGCGGTAAAGAGCGCGGCGTGCTCATCCTCGGAGT
>record2/2
GGACACGCTCTCAGGACGATGGCGCGATTGCAGGACTTGCTGGATCTCCTCCGTCGCCAAGGGGACGCGCTCGGAGTGGCTCATGGAGCAGACGAGTTCT